Ponowne pojawienie się zapalenia wątroby typu B 10 lat po transplantacji nerki

U pacjentów zakażonych wirusem zapalenia wątroby typu B (HBV) zanik krążących antygenów i rozwój przeciwciał przeciwko tym antygenom tradycyjnie oznacza, że infekcja ustąpiła. Uważano, że odporność na całe życie trwa przez całe życie.
Ryc. 1. Ryc. 1. Wykrywanie DNA HBV u pacjenta z nawracającym błonowo-proliferacyjnym kłębuszkowym zapaleniem nerek. Przeprowadzono test PCR z dwoma zestawami starterów. W ścieżkach 2, 3, 4 i 5, startery 1763 i 2032R1 zastosowano do amplifikacji regionu 269-nukleotydowego regionu przedrodzajowego rdzenia. Czułość tego testu została opisana poprzednio.1 Na ścieżkach 6, 7, 8 i 9 zastosowano parę primerów KL12 (5 GGGTCACCATATTCTTGGG3 ) i KL33 (5 ACCACTGAACAAATGGCACTAG3 ) w celu powielenia fragmentu 1089 nukleotydów z obszar powierzchni czołowej. Ścieżki i 10 pokazują markery masy cząsteczkowej (mieszanina fragmentów z rozszczepienia DNA pBR328 z Bgl I i Hin fI); ścieżki 2 i 6, kontrole negatywne, w których użyto wody zamiast DNA; ścieżki 3 i 7, DNA od pacjenta, który był dodatni pod względem antygenu zapalenia wątroby B e (rozcieńczenie, 10-2), stosowany jako kontrola pozytywna; ścieżki 4 i 8, pierwsze próbki surowicy pobrane od naszego pacjenta po przeszczepie, które były pozytywne pod względem przeciwciał przeciwko antygenowi powierzchniowemu wirusa zapalenia wątroby typu B i antygenowi rdzeniowemu zapalenia wątroby typu B; i ścieżki 5 i 9, ponownie pojawiły się najnowsze próbki surowicy od naszego pacjenta, uzyskane po wytworzeniu mocznicy i antygenu powierzchniowego zapalenia wątroby B i antygenu zapalenia wątroby B e. Paski na ścieżkach 2 i 6 odzwierciedlają wyżarzanie nadmiaru starterów i dimerów względem siebie.
Opisujemy ponowne pojawienie się zakażenia HBV 10 lat po transplantacji nerki u 42-letniego imigranta z Singapuru, który uważano za odporny na wirusa. Przed i po transplantacji była ona konsekwentnie ujemna na antygen powierzchniowy wirusa zapalenia wątroby typu B (HBsAg), dodatni pod względem przeciwciał przeciwko HBsAg (anty-HBs) i antygenowi rdzeniowemu (anty-HBc), a ujemny pod względem DNA HBV w reakcji łańcuchowej polimerazy (PCR ) testowanie.1 Reżim immunosupresyjny składał się z cyklosporyny i prednizolonu. Dziesięć lat po transplantacji powróciło błonowo-proliferacyjne zapalenie kłębuszków nerkowych i mocznica, a pacjent uzyskał wynik dodatni pod względem HBsAg, antygenu wirusa zapalenia wątroby typu B i DNA HBV w teście PCR, ale pozostał ujemny w kierunku przeciwciał anty-HBc (ryc. 1).
Bezpośrednie sekwencjonowanie wykazało, że wyizolowany szczep HBV posiadał dzikiego typu primurface, core promoter i sekwencje przedwzmacniacza i należał do genotypu B. Mutację stwierdzono w głównej determinantie antygenowej (a) powierzchniowego antygenu, co doprowadziło do pojawienia się argininy w pozycja 145. Ta mutacja została opisana u pacjentów, którzy otrzymali immunoglobulinę przeciwko wirusowemu zapaleniu wątroby typu B po transplantacji wątroby oraz u niemowląt zaszczepionych przeciwko HBV, którzy urodzili się z matkami HBsAg-dodatnimi. Może powstać przez ciśnienie immunologiczne, 2 ponieważ duża część przeciwciał anty-HBs wykrywanych w surowicy jest skierowana przeciw temu epitopowi.
W raporcie dotyczącym utrzymywania się wirusa u pacjentów po serokonwersji na obecność przeciwciał anty-HBs DNA HBV, stosowany jako dowód obecności krążącego wirusa, można było wykryć w próbkach anty-HBs, 3, ale nie było to możliwe. przypadek u naszego pacjenta Ponowne pojawienie się replikacji wirusa HBV u pacjenta, u którego rzekomo doszło do zakażenia, może być spowodowane ponownym zakażeniem innym szczepem, szczególnie w przypadku hemodializy. Pacjent uzyskał wynik dodatni pod względem HBsAg przed rozpoczęciem hemodializy, a żaden z pozostałych pacjentów w naszej jednostce nefrologii i hemodializie nie jest zakażony HBV o genotypie B; ten genotyp jest rzadko spotykany w Szwecji. Dokładna analiza epidemiologiczna nie znalazła dowodów potwierdzających możliwość ponownej infekcji pacjenta innymi drogami po transplantacji.
Związek między zakażeniem HBV a chorobą nerek jest dobrze znany. W przypadku błonkoproliferacyjnego kłębuszkowego zapalenia nerek, patogenezą leżącą u podstaw prawdopodobnie jest depozycja krążących kompleksów immunologicznych zawierających antygeny HBV.4 Chociaż opisane zjawisko może być rzadkie, nasze dane sugerują, że wcześniejsza infekcja HBV może być reaktywowana u pacjenta z supresją. system odprnościowy.
Karin Kidd-Ljunggren, MD, Ph.D.
Ole Simonsen, MD
Szpital Uniwersytecki, S-221 85 Lund, Szwecja
4 Referencje1. Ljunggren K, Kidd AH. Enzymatyczna amplifikacja i analiza sekwencji DNA przedwzmacniacza / rdzenia u pacjentów z HBsAg-dodatnimi. J Med Virol 1991; 34: 179-183
Crossref Web of Science MedlineGoogle Scholar
2. Hsu HY, Chang MH, Ni YH, Lin HH, Wang SM, Chen DS. Mutanty genów powierzchniowych wirusa zapalenia wątroby typu B u niemowląt, u których rozwijają się ostre lub przewlekłe zakażenia mimo immunoprofilaktyki. Hepatology 1997; 26: 786-791
Crossref Web of Science MedlineGoogle Scholar
3. Bahn A, Gerner P, Martine U, Bortolotti F., Wirth S. Wykrywanie różnych wirusowych szczepów wirusa zapalenia wątroby typu B u przewlekle zakażonych dzieci po serokonwersji z HBsAg do anty-HBs wskazujących na utrzymywanie się wirusa. J Hepatol 1997; 27: 973-978
Crossref Web of Science MedlineGoogle Scholar
4. Johnson RJ, Couser WG. Wirusowe zapalenie wątroby typu B i choroby nerek: kliniczne, immunopatogenetyczne i terapeutyczne. Kidney Int 1990; 37: 663-676
Crossref Web of Science MedlineGoogle Scholar
(13)
[patrz też: citalopram, dekstran, polyporus ]
[więcej w: łupież tłusty, ciosmy, malwa czarna ]